CLUSTER-BUSTER Compiled on Apr 21 2004 >X12345|Your favorite gene (1101 bp) CLUSTER 1 Location: 526 to 549 Score: 6.53 GGAGGGAGGGAGCGAGGGAGCAAC M00196 SRF 526 - 538 + 5.02 ggagggagggagc M00807 CREB 527 - 537 + 4.39 gagggagggag M00807 CREB 531 - 541 + 5.31 gagggagcgag M00807 CREB 539 - 549 + 5.55 gagggagcaac >X54321|Your other favorite gene (1101 bp) CLUSTER 1 Location: 528 to 588 Score: 7.6 GCGGGGGGAAGgtagagAAGGGGAGGGGACAAGccggatcctcccggccgccccggccttc M00807 CREB 528 - 538 + 5.6 gcggggggaag M00196 SRF 545 - 557 + 6.88 aaggggaggggac M00807 CREB 550 - 560 + 4.92 gaggggacaag CLUSTER 2 Location: 140 to 152 Score: 5.54 AGGGGGCGGGAGA M00196 SRF 140 - 152 + 7.61 agggggcgggaga M00807 CREB 141 - 151 + 4.37 gggggcgggag Sequence file: Your_seqs.fa (2 sequences) Matrix file: Your_mats.fa (2 matrices) Expected gap: 1 Range for local abundances: 100 Lowercase filtering OFF Pseudocount: 0.375 Cluster score threshold: 5 Motif score threshold: 4